Turkey microsatellite markers developed at the University of Minnesota

Marker Repeat Forward primer Reverse primer TM product size Genbank number
MNT1 (CA)26 ATCTCCCTCAGGCAGGTATC AGACTCTTGTGTGCCTGGAG 56 149 AF176506
MNT2 (CA)22 CTACGCCCCTTAGTATTGTGAC TGCCTAGCTGTAAGCAAGTCTC 56 135-166 AF176507
MNT3 (CAGA)8+(CA)18 GATCACAGTCACACTCAAATGC TCAGCTGCACAGATCACAGTC 60 108-113 AF176508
MNT4 (CA)21 CGACACTCGAAAGGTGTTC AGCAGCTTTCATCCCATTTG 58 136-152 AF176509
MNT5 (CA)12 TGCTATGATATAAAACACCTCTGG AAAACTTCTTGTGGCTTTCTCC 56 162-193 AF176510
MNT6 (CA)44 imp CAGAGAGATTTACCGTCCTTTG ACCCACAGGATGAAGGAATG 56 142-154 AF176511
MNT7 (TG)11+(TG)7+(TG/TA)12 TGGTAAATTGCGATTCTTGC TAAGAGAAAGAGGGCCAATG 58 199 AF176512
MNT8 (CA)18 GGTGAATTGGCAGACATCAG AGTTATTGCCAGTGCCTGAG 56 146-160 AF176513
MNT9 (CA)18 TGGGAGTGGAAAGGTGAAAG TTCTCCTCAGCTCAGCAACC 58 154-169 AF482368
MNT10 (TG)10+(TTTTG)5 TTCCCAGTGCACTACCTGAAC TGAACAGTGATTCCACTGAAGC 56 273 AF482369
MNT11 (TG)12 TTTCTGACACAGGTACAAGGAAAC GCCCTCGAGTATTAGCCACTC 56 280-287 AF482370
MNT12 (TG)14 imp AGGTGTTTTTGGGCAGTCTC TGCAAGCACCATCTGCTAAG 58 147 AF482371
MNT13 (TG)20 TTAGGGGATGCTGAACTGTG GCGTAATTGGTGCTTTCTCC 58 205-227 AF482372
MNT14 (CA)10 AAACAGAACAACCTCAAGGACAG GAATTGGGTTTGCATTTGAG 58 181-189 AF482373
MNT15 (CA)12 TTGTTGCTGTTGTTTTTGTGG TTTCTGTGCCTAAGCTTAATGTG 58 187 AF482374
MNT16 (TG)13+(TG)11+(TG)8+(TG)5 TGTTTGCCTGCAATAAGCTG GCACCCTCCCACTGACTG 58 199-201 AF482375
MNT17 (TA)5+(CA)29 AGGAGCACCCAGCTCAAAG GAGTAATACCAAGGAAAAGTGTGC 58 174-201 AF482376
MNT18 (TG)13 GCAGGCACAGAGAGCTACG CCAATGTTGAAGCAGGTGAG 58 158 AF482377
MNT19 (TG)22 GCAGGAGGCTCTGAGCTATG TTATACGGAAGGCGGTTGA 58 222 AF482378
MNT20 (CA)15 TAACTGTCTGCCAGGTGGTG GATCTCGGGTGGTGATTGC 56 186-198 AF482379
MNT21 (CA)42imp GGGTCCATTGGAAAATAGGC CTGTGGCCAAAAAGCAGAAG 54 234-334 AY235034
MNT22 (TG)16 TCTGTTTTGCTGTTCATGTTTG AAAATTGTTATATGGGAAGACCAG 58 183 AY235035
MNT23 (CA/TA)28 AAAATAATTGGGCAACTATACCC TTGACAATTAGGTGGCATGG 58 149 AY235036
MNT24 (CA)12 ATGAGCTCTCAAGGCTGCTG GCAAGAGCTTTTGGGAAGG 58 169-171 AY235037
MNT25 (CA)12 TTTGCTTGTTGCTGAGCTTC CCTTGCCAGTGTATTTGCTG 56 112-114 AY235038
MNT26 (CA)20 TGGGTCTACTTTCCTCAAATGG TTTGGGACAAAGGAAAAGTTG 58 119-139 AY235039
MNT27 (TG)15 GATCACAAGCACGTCACAATC CCTGGGTTTGGTTGCATATC 58 166-172 AY235040
MNT28 (CA)17 TTCCTCATCCTGATTTTCTGAAG CCAGGAAAGAAGGAGAACTGC 56 163-177 AY235041
MNT29 (CA)13 GATCTTTAAAGGAAAGCTCACAC AACCTGGAGCAGCACATACC 58 145-156 AY235042
MNT30 (TG)12 CGTGGGATGCATATGGAATAG GGTCAGTCTTGTGAAGGTCTCC 56 203-209 AY235043
MNT31 (TG)12 TCCTCAGGGTGTTTGTCAGG TACGAAATACCCCTCCCTTC 58 153-163 AY235044
MNT32 (CA)18 GGCATTCAAATTCAGAAGACTG GATCACAGACAGGTAAAGATGTGG 58 133-173 AY235045
MNT33 (TG)16 TTACCATAGCTTCTGGTTACTGTG CCCATGCTTACCTTGACTGG 58 116-120 AY235046
MNT34 (TG)18 CTTCCCACATCTAAGGGATTC CAAAGTGCTTCCCCCAATAG 58 219-229 AY235047
MNT35 (TG)24 GGTTTCTGAAGACCACTCCATC TGGTTTTGTGCAACCCTTTC 56 266-283 AY235048
MNT36 (CA)17 ACCAACAGTCAGGTGGTGTG GGAGTATATATATGGTGGATTTGAGG 56 186-207 AY235049
MNT37 (CT)10+(CA)13 AAGGCCTTTACAGAGGAATTTG AGGGCAATGTGCTTTACCTG 56 146-170 AY235050
MNT38 (TG)13 CTGTGTGGGATGGAGGAGAG TCAGTTGGTGAGCAATTGTG 58 187-191 AY235051
MNT39 (TG)13 GATCTCCACGGGATGGTG GTTCTGTTGCTGGGTTCTGG 58 195-207 AY235052
MNT40 (CA)15 TGAACATTGGTAAGTGCCTAGC TCAACAGGTGGGTTATTCAGG 58 133-153 AY235053
MNT41 (TTTG)7 GAGGCCAAAGATGTCCAAAG ACTGGCAGTTCTGAATGAGG 58 139-143 AY235054
MNT42 (TG)17imp GGTTGCTGCTATTGCCACTG GTGACACTTCGCTGACTTGC 58 207-209 AY235055
MNT43 (CT)9+(CA)17 TTGCTTGGGAGCTTATGGAC CCACCAGCACTCAGTAGCAC 58 147-161 AY235056
MNT44 (TG)17 CCATAGCTCTTTCCCCTCAG AACTGCTTTCAGCATTTCAAAC 58 140-160 AY235057
MNT45 (TA)4+(TG)23+(TA)3 ACATGGAGGCAGAGAACCTC TGTCAGCCTGAATGTTTCCTC 60 132-162 AY235058
MNT46 (CA)12 TCTGGATTCTTTCTGGCTCTTC TGAAAGAACCTGATGGGTCTC 58 172-176 AY235059
MNT47 (GTTTTTTTT)4+(TG)17 TTACAACCCTGGCCTTTCTG AAGTTGCAGGTAAGTTCATTTGG 58 138-143 AY235060
MNT48 (CA)16imp TTGTTGCATTTGCAGAAAAG ACAGCAAAAGGCCACTCATC 58 144-148 AY235061
MNT49 (GTT)9 TTTCTTGCCTATCAAACTTCCAG ACTTCTGCAATACGGTGTCG 58 138-145 AY235062
MNT50 (CA)14 GATCTTTTGCAGTCACACAC GCTTGGCCTCATAAGGTGAG 58 181-191 AY235063
MNT51 (TG)15 AAAGTGCTTCCCCTGGTCTC TGCTCAAAGGGGAAGTTCTG 58 195-203 AY235064
MNT52 (CA)12 GACTCACTGGGGTGGTTAGC TTCATCAAAGTGGCTTTAGGG 58 132-144 AY235065
MNT53 (CA)21 TGCTCCTAACCACGAAGACC TTAAGGGTGTGGATGTGTGG 58 172-198 AY235066
MNT54 (CA)18 AAAAGAAGGTGCCCAACTACTAAG AACAGAGGTCAAACATTTTCCTG 58 207-247 AY235067
MNT55 (CA)16imp+(TG)3+(TA)15imp ATAATGCAGCCCAGAAGCAC AAACTACAGCACCGGTCAGG 62 276 AY235068
MNT56 (TG)10 GCAGGACGAGAATTGCTTTC ATCAACCCCAAACAAAACCTC 54 95-101 AY235069
MNT57 (TA)6+(CA)15 ATGGGGAAGTATGGCATTTG GGATTGCATTAGGATACCAGAAAC 54 221-240 AY235070
MNT58 (CA)22 CCCATGCCTTTTATCACAGAG TGCAACAGACTTGCAGCAG 56 271-303 AY235071
MNT59 (T)19+(TG)21 CAGAAATAGTTACATGATGTTCAGC CAATGCATAGCAATAGTGTCCTG 62 138-152 AY235072
MNT60 (CA)12 CAGCTTGCACTGAACCAAAG AACTCTGAGCAGCAGCAGAAG 60 147-151 AY235073
MNT61 (GTTTT)4+(TG)15 TGTCACTAAAGCTTGTTTCATGG AAGCCCAAGATGAAAGACAAAG 58 197-210 AY235074
MNT62 (TG/TC)30 CAGCTTGCATTTCCTCACAG TTGAACATGCTCATCACCAG 58 354-520 AY235075
MNT63 (CA)26 AAGCACAGACAATCTGCTTTTG TTGAACCATGAAACCTCAAGTG 60 151-177 AY235076
MNT64 (TG)15imp GCCGCCGTGCCGTGTG AAAAGCAGCGCACAGTGAAG 62 156 AY235077
MNT65 (TG)11 CTCAGGGAGGTGTATTGATGG TGCCATTCCTCTCTCCATTC 58 254-274 AY235078
MNT66 (CA)24 TTAAGGAGCACCGGCATTAC TTTTGTTCCCTGTTTGTTTGC 56 145-157 AY235079
MNT67 (CA)15 GATCATAAGAAGTTCACACACAC AAGAACCACAAAGGGCTTGA 58 171-175 AY235080
MNT68 (CA)15 CTGTCCACTGTGCCTCCTG ATCCTGCCCACTTCCTTTTC 58 160-168 AY235081
MNT69 (CA)5+(CA)10 ACTCGAGTGCAAATCCCAAC AGTTTTGCACGTGTGTGAGC 58 145 AY235082
MNT70 (TG)10+(TA)10 TGGACCACACAGGTGAAAATC TCCAGTGGACTTTGCTTGAG 58 140-164 AY235083
MNT71 (TG)11 GTGAGAGTGCTCCTGTGCTG CATCCACACGCATAGTGCTC 58 145-149 AY235084
MNT72 (TG)12 GGGTGTGAGAGAGCAGTGTG GGGATCTGGGGATGTGC 60 204-208 AF540398
MNT73 (CT)8+ GGCAGCAGCGCTTGTATTC AGCCGATTCTTCTGCTTCAG 60 132-136 AF540399
MNT74 (CA)12+(TA)6 GATATCCAACCCAAACTTACCC CCCCATCCTTCCGGTTAG 60 222-228 AY235085
MNT75 (TG)12 TGTGGCACAGTGAGGTTAGG GCTGAAAGTGAAGGGACAGG 60 198-218 AY235086
MNT76 (TG)12 GACAGCCTCCAGCGGTATAG ACATGCACTCACACAAACAGG 60 144-148 AY235087
MNT77 (CA)8 CCACCAATTCATCAGGTGTG CTCGGGTTTGGTTTGTGAAG 58 194 AY235088
MNT78 (TG)35imp TTCACTGCTTTGTGGTGGTC CATCCAATGGCAAACCTCAG 58 134-159 AY235089
MNT79 (TG)11 TCACTCATGGGTGCTTCATC TCCAAAGCCATACAACAAGC 58 204-220 AY235090
MNT80 (CA)14 TTTGCCCCGTTTTATCACTC TTTTTCCAAAGCAAAGAGATAGC 58 252-266 AY235091
MNT81 (CA)13 CTGCTCCTGGACTGACCTTC CCATTGCACTGGTGTTTCTG 58 262-278 AY235092
MNT82 (TG)14 CAGCGCTTATCCGTAGTGC TGATGGGGCCAAATAGAAAG 58 162-172 AY235093
MNT83 (CA)13 TTGCAGAAGACCTCAATGACC AACAGGTTGCATTCCGTCTG 58 137-181 AY235094
MNT84 (T)17+(TG)12 GATCTCTTTATTTTCCCTTT GGGCCAAGCGATTTAACAAT 58 143-155 AY235095
MNT85 (TG)12 GGTTTGGAAGAGGAAAGAAGC ATCTCATGTGAGCCCCAGTC 58 250-260 AY235096
MNT86 (TG)13 CACCAGAGCAATGTTAAAAAGC AAGCTGTACGCTTGCACATAAC 60 142-144 AY235097
MNT87 (CA)11 AAGCTGATGTCCCTGTGACC TGCTGCTGCAGTAAAAGCTG 60 185-192 AY235098
MNT88 (CA)34 AAAGAAAATGGAAAGAAGCCAAC GCATCCCAAATACGTGCTG 60 324-344 AY235099
MNT89 (TG)13 TCTGAAAACATCTTTTTCATTGTTG ACAGACAGCCCAGAGAGACC 58 145-156 AY235100
MNT90 (CA)16imp CTGCCCCTTGATTCCTACAG GTGACCAGAGGGCAGTTCTC 58 197 AY235199
MNT91 (T)12+(TG)20 CAAAACACGCACAAGAAATTG CCTGCTCCATTGAAGATTTTG 60 169-177 AY235101
MNT92 (CA)17 AGTAATGCTGCCCCTACGTG AGCCTCTGCTGGTTGTCAAG 60 100-110 AY235102
MNT93 (CA)23imp TCTATCTGCTCGCTGCTTCC CACAGCGCACACTCTTTCTG 58 171-196 AY235103
MNT94 (TG)15 AAAACTCCTTTCTCCCTGATTG GCTGTCACGCATTACATTTTG 60 147 AF540400
MNT95 (CA)16 TAGCAGAGGCTGTGGTGTTG TCTACTGCACTGCTGACTTGG 60 161-165 AF540401
MNT96 (GA combinations) 544 bp TCCCAACCTCCAGTACTCTG CCCTGGCATTTATTCTCCATC 54 694 AY235104
MNT97 (CA)20 GATCTTTCTTCACACGAGAGTCC CCCTGAGCCTCCTTTTTCC 62 243-267 AY235105
MNT98 (CT)21 imp CTCGGAGAAGAGGTGTCCAG TCCTTTGAAGAGCAAAAGTGG 58 167 AF540440, BI335613
MNT99 (CA)25 imp CCTCCAACTCAGATCTCAAACC CTCTCTCCCTCGGCTTTCTC 60 216 AF540402
MNT100 (TG)9 TTGCAAGAGTTGAAAATCAGG ATGCACAGCAGTTCATCTGG 60 148-156 AF540403
MNT101 (CA)16 imp CTTAGGAGGGTTTGCTGGTG TGAAGGAAACACTTTCAGTCG 60 149-151 AF540404
MNT102 (TG)12 CAGCTTTGCCAAAATTTCATC TCCCTCTGGTCTCCAAGTTC 58 149 AF540405
MNT103 (TG)12 GTAATCAATGGCGTTTGTGG CTGCCACACCAGGACTCAC 58 138-146 AF540406
MNT104 (TG)15 CTCATGTGTTGTGGCTGGAC TTGGTTGAAAGTGCTGATGC 58 152-164 AF540407
MNT105 (CA)15 imp TTTGCTGTTCTTCCCCTCAG AACAGCAGCACACTCCACAG 58 141-145 AF540408
MNT106 (CA)14 TGCAGTGTGAATATTGGCTTG AAATAATGAAGACACCGACATTTTC 58 158-168 AF540409
MNT107 (CA)18 AGAGACGGCGGAAGAGAAC GTGTCTGGGTGTGTTTCTGG 58 153-159 AF540410
MNT108 (TG)17 TGGATGCAGTTCCTTCAGTG CATGCAAATACAGCATGAGG 58 182-203 AF540411
MNT109 (TG)17 imp CCAAGACATTTGTTCTTGACC CACCGATACACCCACAAAAG 58 202-204 AF540412
MNT110 (TG)20 GTGCGTGGTGTTGTAAATGC AAACAGGTTCAGGATGCAAAG 58 174-176 AF540413
MNT111 (CA)11 GAGACCTGCCAAAAGTTATTGTT GACTTAGTTTTTAAGTCTTGTACCTG 58 156-165 AF540414
MNT112 (TG)12 AGCAGCTGTTGTTTCACTGC TGGAAAGCGCACAAGAAAAC 58 217-245 AF540415
MNT113 (TG)15 imp CTAATTGCCCGCTGTTGC ATGCCTATGCACAGCAAGTG 58 178-179 AF540416
MNT114 (TG)16 CAGGGTTTGGGGAATAGGTT CTGCGGCTGGGTACCTG 58 145-153 AF540417
MNT115 (CA)15 CCTTGCCAGGCTTTTCTTC GCTTGCATAGGCTTCGTAGG 58 136-185 AF540418
MNT116 (TG)15 TACAAATGGGGCATTGCAG TGAGACATATGAGTAGGGCTTAGG 58 141-162 AF540419
MNT117 (TG)19 TCTTCTCCCTTCACCACCAC AGCCTGGATTTCAGACATGG 58 169-173 AF540420
MNT118 (CCCT)4+(CT)4 CCCTCTCTAATAGGGCCTAGC TCAAATCACGTGAACAATTCG 58 141 AF540421
MNT119 (GT)13 CCTTCCGCATCACCTCTATC AAAGCCAACACTTGGGTGAG 58 138-140 AF540422
MNT120 (TG)12 imp AATCAGGGGTTTAGGGTTGG ACACAGACAGCGGCTGAAC 58 156-166 AF540423
MNT121 (TG)8 CGTGGATTTTCAGGGATACG CCCTGAATGTGAACCCAGAG 58 138 AF540424
MNT122 (TG)17 imp GGTGCTGAGGTACGAAAACC GGGCTTGAAGAAAGAAAAGACC 58 110-132 AF540425
MNT123 (TA)3+(CA)6 GTGAGCATCTGCTTTTCAGC CAGCGTCGGTGTGTTCTG 58 238 AF540426
MNT124 (CA)9 imp GAGCAGCAGGATCAAGGTTC TGTTACGGATGTGTTCACAGG 58 152-154 AF540427
MNT125 (GT)9 GATCAGAGCTCCTCCAGTGC TTGGGAAGACCCAGTGTTTG 56 235 AF540428
MNT126 (TG)14 TTACCCTTTTGCCAGGAAAC TTTCTCTTGGATGTGACTGGAG 56 180-204 AF540429
MNT127 (TCC)6 GATCCTTTTCTTAAGCATCGTG AGAAAAGGGTGGGAGGAAGG 60 210 AY235106
MNT128 (CA)16 GCTGGGCAATACGTTCACTC CAGAATGGTCCAAAATGGTC 58 162-170 AF540430
MNT129 (GTTT)7+ GATCTCTGACACTTTACAGGTG TGCATCCTCCCATAGGAAAG 58 156-160 AF540431
MNT130 (GGA)11 imp AGTTCGCCGGCTTCTTAATC CCAGCTGAAACTGAGCTTGC 58 136 AF540432
MNT131 (GGA)13 imp ACCGGCGGTTTTGTGAAC AGCCAATTGAGGTCCAACAG 56 140-143 AY235107
MNT132 (CT)13 + poly A TCAGCTGAAATGCAGACCTC TCTCTTCATAACATAACTCTTCAAAGG 58 174-184 AY235108
MNT133 (GA)13 TTCACCGAAAACGAATCTCC AAGACAAACTGCCTTTTGCAC 58 148 AY235109
MNT134 (CT)13 TTATGCTGTGACAGTGCATTC AAAACCATGGGTCTGTTGAG 56 166 AY235110
MNT135 (GA)50 imp GGCAGCAAAGGTTGGTACAG CCCCTCCAGTACATCTTCAGC 58 209 AY235111
MNT136 (CT)17 CAACAGGCGACCAAAAGAAG AGCCATTAATCAGCCTGGTG 58 143-167 AY235112
MNT137 (CT)15 TAGTTCAGCTGGGAGGAAGC TCCCAAGAACAACAAATATTCC 58 188-196 AY235113
MNT138 (GA)20 TGAACAATTTTTCTGTTGTCTATCAAG CAGGTCTCAAGCATAGCACAAG 58 163 AY235114
MNT139 (GA)18 AATTAATTGACAGCAACAGAAAAA TCCCTGAGCTGGGAAAAGTA 56 125-158 AY235115
MNT140 (CT)16 ATTGCTTTGCTTGCTTCAAC TGGAATCAGCATTTCACCTG 58 141-165 AY235116
MNT141 (GGA)6 ATCGAGTACCTGGTGGATGG GTAAGAGCAGCGCCGTTTC 56 388 AF540433
MNT142 ( CA)23 +(CT)3 CACTGCCTGCTTTCACACTG GCATGTTTATCTATCTGCTCATCTG 56 226-230 AF540434
MNT143 (TG)14 GGATGGGGATCATAATTGTAGTG GGAATGATTCACCTGTGAGC 58 146-154 AF540435
MNT144 (TG)20 imp AAACAGAGGTGATGGCAAAAG AAATCCTGGGAGCTCCACTC 58 169-185 AF540436
MNT145 (TG)12 imp TGTTGTGGTTTGCTTTCTGC GGCTCTTTGCTGGTCTTGTC 58 205 AF540437
MNT146 (TG)14 CCACCTCTTCCTCCTTTTCC CTCCCTCTCTCGCCACAC 60 154-168 AF540438
MNT147 (GA)11 CAGGGAGCGGCAGCAA GAGGGGGCAGTCAGGAG 62 117 AF540439
MNT148 (CA)13 CGTGAGCCCTGAGTTTTAGG GCTGAAGTGTGAGGCACAAC 58 130-144 AY235117
MNT149 (TG)12 GTAGGCATTGCTGGGAACAG CAATGACAGCACGAAGCAAG 60 129-145 AY235118
MNT150 (CA)14 + poly A ACCCTCCTTTTCCCTCACTG TGTCACTCTGGGATTTCAGC 58 135-149 AY235119
MNT151 (CA)20 + poly A CAAAACAATGTTGGAAAGATTAGG TGGAGTTCCAAAACCCACTG 58 145-157 AY235120
MNT152 (GT)8 + (GT)12 GTATGTTTGGAAGGGCAAGG CCCTGACTACGGCTTACGAC 58 181-192 AY235121
MNT153 (GT)14 TGGGATTTGGGAAAGAATTG CATATGACATCATGTGGAAGGAG 58 252-274 AY235122
MNT154 (GT)24 + (GA)7 GATCAGGTGAGAGCTGAGAATTAG TTTGGAGAACGTGCAAGAAG 60 160-208 AY235123
MNT155 (CA)15 CACATGGCTGAGTCAACTGG CCTGGAAGCTGTGCAGTAGG 58 188-202 AY235124
MNT156 (CA)13 GCAAAGGTGGGTAAAAGGTG TTCACATGCTTTTACTTGAGACATC 58 120-128 AY235125
MNT157 (TG)11 TGGAGCTCGTTAATGGTTTTG TGGTAGTTTAAACCAGCTGTGG 58 151-159 AY235126
MNT158 (CA)22 TCCCAAATCCTAATCCCCTAC TGTCATTCCATCTGTTTCGTG 58 170-198 AY235127
MNT159 (CA)11 CAGCAAGAATAAGTTTCCTCACC TGAACTCAGCTGCCTTTCTTG 58 160-162 AY235128
MNT160 (TG)5A(TG)13 CCCAGTATTTTCCACTGGTTTG GGTGGCACAGTCATATCAGC 60 117-157 AY235129
MNT161 (CA)19 TTCTTTTCTGTATCCTAAACAATCTCC ATTTCCAAGGCTGAAAGTGG 60 135-143 AY235130
MNT162 (TG)12 AAAAACCTGAAAATGTAAATCCA TTCAGATCTTTTATTTTTCGAAGC 58 94-100 AY235131
MNT163 (TA)9CA(CATA)2(CA)8+(TA)6(CA)12 TCAAGATATGCCAGTTTGGACA GAATTCCTGTAATGTGTGTAT 58 133-157 AY235132
MNT164 (CA)16 GCACAGTAACCTTTCAATTCAGC AACATGGCATTGTACCAGACAC 58 145-173 AY235133
MNT165 (TA)5+(CA)12+ CAGTTAGCTTAAACTATGCAAAACAAC AGCCCCGTAAGCATCTTGTAG 58 166-168 AY235134
MNT166 (CA)14 GAATTCACTGATATTTATTTTGC GAGGTGGCAATATCTTGAAATG 58 131-137 AY235135
MNT167 (TG)18 AATTCTGTATCCAGTCATTG ATTAGCAGAGGTGGCAGTGAAG 58 156-180 AY235136
MNT168 (CA)22 GTGCATGAGAGCTCTAGTGTGG AGAGAAGTGGGTGCAGTCTGTC 60 340-378 AY235137
MNT169 (TG)14 AGGCAGCATTTCAGGTTTTG TCCCTTCTCAAATTCTTGCAG 58 143-159 AY235138
MNT170 (GA)23 CTTACCCGCTCACACTCCTC ATGGTCCTCCTGCCTTTACC 60 146-154 AY235139
MNT171 (TTG)10imp AGAGGGAAATGGAGGAGGTG GGGAGGAATATGACAGAAAGG 58 275 AY235139
MNT172 (TG)22 GTCACAGCCTTTTCCTCTGG CTGTGCTGCATATATCCATATTAAC 58 145-163 AY235140
MNT173 (TG)13 TCACCTCTTTGAACCAACTCC CACTTGAAGCAACACTGATCG 58 143-163 AY235141
MNT174 (TG)14 AAAATTCAGTCCCCCAGAGG CTCAGGATGCAAGCCTTCTC 60 204-216 AY235142
MNT175 (GT/AT)13 TCCCTCTGGGAAACACAGAC GAAAACCGTTGTGGAAATGC 60 146 AY235143
MNT176 (TG)17 AGCCATCCCATTTTCTTTTG GCTGAAATAGTCCACCCTGTG 60 147-156 AY235144
MNT177 (CA)18 GCTAACATAATGGCCACAGC GCCCCTGAACTCTTTGTAGG 60 181-195 AY235145
MNT178 (TG)24 GGGGATGCGTATGGAAAATC CTCCGACTCCCATCTCCTC 58 108-118 AY235146
MNT179 (CA)20 ATTCAACGCCAGCAGTTTTC GCTCATCGTAGCACAAATGC 56 151-179 AY235147
MNT180 (CA)11 TTCATACCTTCCCCATCTGC GGGGTGGTGTCATTTTAAAGC 60 138-140 AY235148
MNT181 (CAAAA)4 + (CA)12 + (CCAA)5 GCTCCTAACTAAGGCAAAACAAAAC TTCTGCTTCTTTCATTCTTCTCG 58 136-146 AY235149
MNT182 (CA)13 imp CATGCATGCCCCAAATTC GATCAAGCTGGTTTGCCTTG 60 130 AY235150
MNT183 (TG)11 AACAAATAAACAGGGCCACTTG CTCAGCATAAATCGCCAAGG 60 176-180 AY235151
MNT184 (TG)14 TTCCTCTAAGCCAGCAAAACAG TTTTCCGATATTTGTGGAGTGG 60 148-150 AY235152
MNT185 (TG)15 GAATGTCACTCTCTGCCTTGTG AACTTCCTAGCTTCCAGAAATCC 60 195-202 AY235153
MNT186 (CA)10 TCAAACAATCTACCAATCACGAG CCCATGCCACCATTATACAGTC 60 151-159 AY235154
MNT187 (CA)10 AGGTGCTTGAGAAGAGTCAGC AAATGCCATGTCAGTCTGAGG 62 213-243 AY235155
MNT188 (TG)20 GGAATAGCTCAGTTCATTTCATTC ACGCACTCGGGATAATTTTG 58 248-264 AY235156
MNT189 (CA)15 TTCTTTCCATCCTCCCTTCC TTGTGTGGCTGTTTCAGAGG 60 236-246 AY235157
MNT190 (TA)7(CA)10(T)(CA)12 GGCTCTGTTACACTCTCCCTCTC TCCCACTTGACCCTTTTAATG 58 64-148 AY235158
MNT191 (TG)11+ (TG)7 TGTCATTTTCTCAGCTGAACG CCATAAGCAACGGTTAACAAATAC 58 112-116 AY235159
MNT192 (CA)15 ATTGGTCAGGGTGCCAATAG AGCACATTGCAGTTGTTTGC 60 203-219 AY235160
MNT193 (CA)16 GCAGTCATACTCCTTGGTTTCC TTGCCTTTGACAACTTCTGC 60 168-176 AY235161
MNT194 (CA)12 + (CA)16imp GGAAAAGAAACCCACGAAAC CAGAACGAAAACTCTGTTGTGG 60 138-164 AY235162
MNT195 (CA)15 TTTTCCACCTCAACAGCAAAC GGCCACAGGAATGACTTTTG 60 153 AY235163
MNT196 (TG)12 TGGTTCTTACTTTGCTTGCAG GCTTCACAGTCCAGTTGCAG 60 165-175 AY235164
MNT197 (CT)22 GCTTACGGAGATAAGAGCTTTGG CCACATTGCAGAGGGTCAC 60 105-117 AY235165
MNT199 (CT)13 AGCTTCCTATTCAAGAGTTTTGG AGTCCAAGACCAGCCACCAG 60 136-150 AY235166
MNT200 (TG)19 TCTTCTCTCAGCCATGAAACTG TTCACCATACACATGAAACACTC 60 133-145 AY235167
MNT201 (CA)17 + (AAAG)5 CCACTTGGTGTTCTACTGCTG GCCTCAATGAATGCAGTGTC 60 250-526 AY235168
MNT202 (CA)12 TCCCGTCTTGTGAATAAAAGC GAGGACCCGAAAAGAAAAGG 60 178-192 AY235169
MNT203 (TG)13 GGTTCCCAGAACTCCTTTTG TGACAATAACGGCAAACAGC 60 157-164 AY235170
MNT204 (TG)32 CCAGGAGTTGGATCTGATGAC TTTTGGGAAGCTGGTATTGC 58 131-181 AY235171
MNT205 (CA)12 TGCCACTTGCAACCTAAATG CGGAAGACTGATTTGGCAAG 60 144-154 AY235172
MNT206 (TG)20 CAGGCACAAACTGAAACGTG TGTGCCCATTGAGAACAGAC 58 187-362 AY235173
MNT207 (CA)12 GAACGCATTCTGGAAGATACAC GCTGAAATTCTGCCATTTCC 60 133-149 AY235174
MNT208 (TA)11(CA)15(TA)3 GCCGTTCAGAGTACTTTCCAG AATTTCCATTTGTGGAGACG 60 303-328 AY235200
MNT210 (CA)14 TTAGCAAATGGGTGAGAGCA TCTACTCGTTTGGGAATCTG 58 108-118 AY235175
MNT211 (CA)27 TTTTCCCATGACCAAGTGAC TTGCATTGGGAAGGCTTAAC 58 186-212 AY235176
MNT212 (TG)14 GCTGGTCTTGAAGTCACCATC TCTAAAGATCTCAAAGGGCTTG 60 194-202 AY235177
MNT213 (CA)17 CATCATTCCCCAATGCAAG TGGAAATTTGTTTTTCTTTGCAC 60 167-186 AY235178
MNT214 (TG)26 GCCATGAATGTCAAAAGGAAC GGGTGAGCCTGGGTAGAATG 60 190-206 AY235179
MNT215 (TG)29 GTGGCCAATGCCTTCTGTAG CACACAGCAGCAGTTCCATC 62 110-162 AY235180
MNT216 (CA)13 CCCCAGAGTGATGAAAATGG TTATTTGTAGCCACATGAAAACAG 60 133-160 AY235181
MNT217 (CA)14 TCATTTCACACAGCACGATG TTCAAACCACTGGAGTTGGAG 60 141-159 AY235182
MNT218 (TG)16imp ACAGCGCTGGGGTGACAG GGTGCGGGGGGATCTTAC 60 70-78 AY235183
MNT219 (TTTG)8 GAAGGGCTGAAATTCCTATTCC TGTGCTGCCCAAAGTATTCC 60 136-150 AY235184
MNT220 (CCT)20 imp TGGTTTTCTTCCCGTCTAGC TTCGAAATATGGCGGAAGAG 60 173 AY235185
MNT221 (GCT)8 TGAGCCCTTTACAAGAAGCAC CACGGTTTCTATGGGACAGG 60 195-201 AY235186
MNT222 (CAG)6 CCCAAAAGTCCCACGCTAAC GAGGTGCAAGCTCATCTTACC 60 154-158 AY235187
MNT223 (TG)15 CAGGTGGATGCACTGCTCT TTGCTAGAAAGATTTTTAAGAAGCAC 60 126-142 AY235188
MNT224 (GGAA)19 TCTCAGTACTCAGCAATGACCAG TTTTGTCAAACAAGGTTGTAATAATG 60 189-233 AY235189
MNT225 (CT)18 imp + (CA)11 imp ACCACCTCATTCCACGAAAG TGCTTTCTATAAGCTGCAAAGC 58 189-215 AY235190
MNT226 (CA)24 AAAGCACAAGCTGCTGCAC TCCACCCACTTCACACTCAC 58 149-183 AY235191
MNT227 (TA)15 CATTGGAGTTGCTGTGTTGG CCCAAATGTACAAAGGCAAG 58 152 AY235192
MNT228 (CA)13 TCTCCTCTTTGCAAGGCAAC TTCAGTGCTTTCATTTATGAGG 56 145-153 AY235193
MNT229 (TG)14 TTTGGGTGCTATCAGAGTAAACC GCCCTTTGCCCTGTACTCTAC 58 162-171 AY235194
MNT230 (TG)14 GCCATAACACCAACATCTGC AATTATGCACATACAAACCTCTACA 56 142-148 AY235195
MNT231 (CA)21 AGGTGCCAATGTTCCTTCC TTTCCCATCTTCCTGGTACG 58 123-145 AY235196
MNT232 (TG)26 TGCCAGATGCATTGTGATG GAATTCAACTGAGGAGTTAGGC 58 194-204 AY235197
MNT233 (CG)6+(CA)15 TCCTTGCAGTACATTAATCTGAATC CTGGGAAGACTTCGTGCTG 58 133-147 AY235198
MNT234 (CA)10 ACCAACTGCTGTTCGTCTCC GACATCAAATGGGAGAATTTGG 60 165-168 AY552806
MNT235 (CA)15 imp TCAGCCACTGGAAACATGAC   GGGAGTTCCTCAACCTCTCC 60 191 AY552807
MNT236 (TG)15 imp CTTGGCTGTGTGACCTGTG TCATTGCAGCTCAAGACCAC 60 147 AY552808
MNT237 (CT/CA)12 TTCACATGGCTTCCAGTTTC  AGTCAGGATGATGGCAGTCC 60 108-113 AY552809
MNT238 (TG)11 TCTTACACTCGTTGCTTGGTG CAATCACAAGTTGGCCTCAG 60 100-108 AY552810
MNT239 (TG)14 CCAGGTGCCTCCCATATTAC  GGGAGCAACTAATGGTGTGG 60 178-182 AY552811
MNT240 (CA)12 TAAAGCAGGGCACAGTTCAG TGCTTCTCTTCCAGCTGTCC 60 146-156 AY552812
MNT241 (TG)13 GGCTGTTGCTTCACATTTAGG  CTGGCATTCTGCTGCACTAC 60 112-118 AY552813
MNT242 (CA)16 TCAGTAAAAGTGGCCAGTGC AGATGCATAAGCATGCAAGG 54 106-126 AY552814
MNT243 (TG)16 imp CTCGCCTACAACCAAAGGAG GCTAGAGCCCACTGTGTTCC 60 127-131 AY552815
MNT244 (CA)30 imp AATTCCAAAAGCCAGTGACC TGGAACACGTGCTTTGATTC 58 135-164 AY552816
MNT245 (GA)16 GCAGGCAGCTGCACTATTTC GGCAGGAGCCTTCATAACAC 60 172-190 AY552817
MNT246 (TG)20 GTGAACAAAGGCATGGTCAG AATTCTTGCCTTGAAGGTTTATATG 60 280-288 AY552818
MNT247 [CA]14TTTT[CT]7 GAACAACTTGAGGCCATTCC TTCCAGCCTTCCCTAATGTG 56 274-302 AY552819
MNT248 [GA]5 AAACTTTCTTCCTCCCAGTGC TGCCTGGCATATTTATGATTCTC 60 207 AY552820
MNT249 (GGT)5 GGGACTTGTGGCTGTGATG GATCCACACAGAGAGCAGAGC 60 201 AY552821
MNT250 (TGG)7 GGATTTGCAGCTGTCCTCAC CAGAGAACCCTCGGCTACTG 60 185-183 AY552822
MNT251 (GGA/GA) comb ATCCCTATCGGCCTCGTG AGAGGTTAGCAGCCGTTCTG 60 248 AY552823
MNT252 (CAG,CAA) comb TGGCTTTTCCTGCTTTTCAG TTGCTGTGCCTGAGCAAC 58 248 AY552824
MNT253 (CA)11 TGTTGGTGACCATTAGGAAGG TCTGCCTATTGGAATATTCTATGC 60 181-187 AY552825
MNT254 (CA)16 imp TTCAGGATGTACTGAAAAACATAGC TCCCTTTGCTCTTCTTTTGG 60 222-254 AY552826
MNT255 (CA)12 AGTTGCTGAAATCTCCTGTGG CAGAAATGGAACCAAGATTGC 60 169 AY552827
MNT256 (CA)10 TTTCCCTTCCCTTTCCTTTCC CAGAAAAGAAATTAATCTGGGCATTC 60 246-252 AY552828
MNT257 (CA)14 TGACATTGTGAGGCTTCTGG ATTTCCTTGCTGCCCTTTG 60 177-185 AY552829
MNT258 (AT)16 imp (CA)12 imp ATAGGAGGCATTACTTTCAGAGC TCACAATCCTTATGAACATGCAC 60 144-148 AY552830
MNT259 (TG)21 imp CCCACTTACTTGCACTGTGG GGAGAAGAAATGAAGGCTTCTG 60 100-107 AY552831
MNT260 (TG)16 imp TATGTTTATTCTCTATATGAACCTG CCAAACTGCCATCATTTCTG 58 160 AY552832
MNT261 (CA)10 TTGGTACTTCAAGGCAAAACTTC TGTGACCTATTCATGCTACGG 60 166-170 AY552833
MNT262 (CA)15 GCATGGTGCAATGTTTATGC TGTGATGTGCCATTTTCTGC 60 233 AY552834
MNT263 (TG)20 CGTTACTTTTCCTGAGATGTGG ACCCCAACAGTAATGGCTTC 60 229-231 AY552835
MNT264 (TG)24 imp TCCCAGAATCCTTTCCAAAC TGAAGCATCAGCAGGACAAG 60 165-171 AY552836
MNT265 (TG)17 imp CACAAGTGATGCTGGGTCTG GCCAGGCATCTCAAGAAAAC 60 202-208 AY552837
MNT266 (TA)5(TG)11(TA)5 ACCATGGTCCTTTTGTCTCC ATCACATCCTGCTTGGCTTC 58 243-271 AY552838
MNT267 (TG)12 GTGCTGGTGCCAGTAAATTG ATGGCATGAAGATGGGTAGC 60 82 AY552839
MNT268 (TG)11 TTCCAGGCTTTTCATTTTCC CTCATCTCCTGCTGGCTTG 60 198-210 AY552840
MNT269 (TG)15 imp TTTTACAGTTCAGACCCAAGACAC GGATTCCTGGTTACCATTCAAC 60 171 AY552841
MNT270 (TG)15 TGCACAAGAGCATCTCAAAG TTAAGCAGCAAGAGGAGGAG 60 230-244 AY552842
MNT271 (TG)16 TTCTGGCACACATTCTCCAC TAAAACAGCCCTCCTTCCTG 60 189-191 AY552843
MNT272 (CA)12 TGGAACAGACTGACAGGAACC TATCTGCCTCACCGTGTCTG 56 110-140 AY552844
MNT273 (CA)13 (CA)6 (CA)3 (CA)5 ACTGCTTCGATGGCAGAGAG GAATTCAGCTGATGCAACC 56 250-258 AY552845
MNT274 (CA)15 imp (CGGA)4 TGGCTCCACCTCTCCTACAC TTTGATCAATGGATATACAGATGG 60 246-258 AY552846
MNT275 (GCT)60 CCCATATCATCCTGGAGCAC AGGAGAGAGCCCTGCTGTG 58 218 AY552847
MNT276 (GGAA)18 imp CCAGCCTGCTTGCTTAAAAC GCTTTGCCATGGTAGACTGAC 58 277-297 AY552848
MNT277 (TG)17 AGCACAATATGTCTCCCAAGG GGCACAGATTCCTCTTCCAC 60 105-123 AY552849
MNT278 (TG)10 GCTACATGACACCAAGCACTG GCTGCTCAGCTACGTGAAGG 60+ 214-228 AY552850
MNT279 (TG)14 TGAGGGGTAGTTAAGGTTGTGC AAGCAGCCCTACCTCAAAGC 58 120-126 AY552851
MNT280 (GA comb)327bp ACGCACACACGTACCAACTC ATTAGGAACCCGAGATGCAC 58 485-545 AY552852
MNT281 (CA)26 ATCAGTGCAACGATCCAAAG ACATGTGTGCTGGTTGTTGG 58 246-280 AY552853
MNT282 (CA)11 ATGTGCAGAAACCAACACCA CTGGTCGGCTATTTGCTAGG 58 231-239 AY552854
MNT283 (TG) multiple GGGATAGGATTGTCCCCTCT TGCCCTTGTTAGCAATCACT 58 410-472 AY552855
MNT284 (TG)21 AAAGGTTAAGGATTTGAGTTTCTGTC TCATGCTCCCTGAAGTCATAGC 58 299-305 AY552856
MNT285 (CA)20 GAATTCTAATTCTTCCTAGAGATGAGC GAGAGAAAGGAAGCGAGCAG 60 220-250 AY552857
MNT286 (CCTT)35 imp TAGGTGATGGACCCGAGAAG TTCTATATTCAAGAGATGCATGTAGG 58 245 AY552858
MNT287 (CA)13 TCTCCTTTCAATATGCCATGC ACATGGGCATTCCTAAATCC 58 244-250 AY552859
MNT288 (TG)12 CAAATAAGAAATCATCATAATCCTTGG AAAGGCAACTCTAGTCGTCAGC 58 241-249 AY552860
MNT289 (TG)16 GGTTATCGCCAAGCGTAGAC AGGAACACAGCCAGCTTTTG 58 230-240 AY552861
MNT290 (GT)15 AAATGGAAGAGGAAAATGGAAAC GCAGGGCATTGGTTAGTGAG 58 150-160 AY552862
MNT291 (TG)14 (TCTG)5 CCCCTCGAAATCAATAGCAG TGTTTCAGCAGGTCTGCATC 58 139-162 AY552863
MNT292 (TG)15imp AATGCCTGTGTCAAGTGCAG TGGCACTACATTTTGCATGTC 58 132-163 AY552864
MNT293 (CA)21 CTGCCTTCAGTACCTTGCTTC ACATTTCTTCAGGGAAGTAGCC 60 186-188 AY552865
MNT294 (CA)11 CTGCCACTTCTCCCCTACAG AAATGGACTCCAGCATTTGG 58 217-225 AY552866
MNT295 (CA)12 GGACTATTCAGCACACCAGAAG TGCTGAAAGATCTATGAGTTGG   155-165 AY552867
MNT296 (GT)27 TGGACATGGACTTGAGGTTG AACTTCAGTTTTGTAGGGAAAGC 58 145-183 AY552868
MNT297 (GT)26 CCCAAAATTGCACCTTACAG TGAATGCATTTAGGCTTAGTGAAG 58 367-394 AY552869
MNT298 (TA)19imp (GT)17 TCTTTTGATCCTTTATCACACAATAAC AAAGAAAGGAAAGCCTGTGTG 60 176-179 AY552870
MNT299 (GT)25 (GA)11 CCATGTCACACTGGCTTCTG TCATAATAATAGTTCTGTGCATAACTCTCTC 58 254-258 AY552871
MNT300 (TA)6 (CA)12 TCCTGGATTTTCCCACTCTG TTTAGATAGCACAACGCAGTTATAG 58 257-367 AY552872
MNT301 (CA)24imp GATTCAATTCTATTTTATGAATTTCTGC AACCACAGAGGAGGAAACAATC 58 160-176 AY552873
MNT303 (CA)14 AAAGGCATCCACTGCTGTTC CGGTTGTCTGTTTTGAGGTG 58 353 AY552874
MNT304 (TG)14 GAGCAGGATACCCTGGAGTG AAAACAAACAAGCTCAGTCAGTC 60 192-197 AY552875
MNT305 (CA)20 AAGACAGAAAATGAAGTGGGAAAG GAGTTGGCCAGAAGGATGAC 56 179-193 AY552876
MNT306 (CA)15 GCTGGTGTGGACATAACTGG TGTTTAGGAGGCTGCAGATG 56 219 AY552877
MNT307 (CA)11 TAGCAGTGACCACAGGATGG TACAGGGTACGCTACAGATATGC 56 283-290 AY552878
MNT308 (TG)10 CAAGTGCTCTGATGCTGTGC GAAAGGAAACGTGCTCTTGG 58 250-282 AY552879
MNT309 (CA)22imp CAGTTTCCCAGGAAATGGAC ACTCTCCCCAAGGGGTAAAC 56 172-190 AY552880
MNT310 (GT)4 (CA)16imp AACCAAACACTTCCCCTTCC AGCCACATTCTGCTTCTTGG 56 268-272 AY552881
MNT311 (TG)17 ATGTGGCTGCAGAGCAAAC GTCGTGATTTGTGGCAAGTG 56 134-160 AY552881
MNT313 (CA)14 GCTTTTCTTGAGAAACGGTTG AGGGATTGGTGGTTTCATTG 56 116-141 AY552883
MNT314 (CA)14 CCGCTTGTCCTGATTCTCTC ACTCAATGGGCTGAGCAAAC 56 252-254 AY552884
MNT315 (CA)11 CCCCTTCAGCATTGGTTATG CCTGACTTAAAGGGCTGCAC 60 204 AY552885
MNT316 (CA)11 ACACTTCCCATTTGCCTCTG TGAGTTATGGGAACCTGATGC 56 302-338 AY552886
MNT317 (CA)11 AAAGTTTTGCAACCTTAAACTGG TTCTCCCCATGGTAACACTTG 56 229-238 AY552887
MNT318 (CA)13 TCACGCTGTCTGAAAGATGG GCCCTTTCACTGAGACTTCC 56 189-198 AY552888
MNT319 (TG)14 TGCAAAGGCAATTATTTTCTCC ACAGGGATGTCATGGGAAAG 56 293-300 AY552889
MNT320 (CA)16imp (TACA)9 AGGATGTGGATGGCTGTTTC TAACCCTCTGTGTGCTGCTG 56 200-210 AY552890
MNT321 (CA)21 TGATTTGCTCATCGACTTGC ATACAGAGCAGCGCGAGTG 56 212-240 AY552891
MNT322 (CA)11 ATCCCCTGCAGCTTTTCC CAAGGCAGCGAGAAGGTAAG 60 196-204 AY552892
MNT323 (TG)12 GCTTCGAGCACTGATATCTCG AAAATTAAAAGTTATGTGCTAGCTTGG 60 165-174 AY552893
MNT324 (TG)14 AACTGCAGTGTGAGGTGCAG TGGATAGCATCGGTAAGCTG 56 260 AY552894
MNT325 poly T + (TG)18 TGTTGGAACTGCAGGACTGA GAATTCATTGACACATACACAC 56 110-120 AY552895
MNT326 (TA)3(CA)12 TTCCAATAGTGTTTCTGTTATTTATTG AGCGGGAGGTACAGAACAAG 249 247-249 AY552896
MNT327 (CA)12 TTGTGTTATGCAAGTAAAAGCATC GGCTAACCAGAGCTTCATGC 60 205-213 AY552897
MNT328 (CA)10 TTTGCAGCTCCATTATGACG CAGGAGCTCACTGTTCTGG 60 194-202 AY552898
MNT329 (TG)14 TTCTTGCTTTCAGTGAACACG GGGAGAGAGCACATTTCAGG 60 231-241 AY552899
MNT330 (TG)14 GCCTTATAGGAAGGCTGTGTTG AAGGGTTGTGCAAGCATTTC 60 201-211 AY552900
MNT331 (CA)13 AGGGACAGTCAGCCACATTC TCCTTCTGCAAGATGACACAG 60 156-184 AY552901
MNT332 (CA)24 TTGGTCAACATTTGGAAGACC ATTAGCTAACAGCTGCAAAATGG 58 149-161 AY552902
MNT333 (CA)14 TGTCTGGAGCAACGTGGTAG TATGGCCAACCAAATGACTG 60 277-279 AY552903
MNT334 (GT)15 TTGAGTTAAATGCCTGGTTGG TGCAAAGATTTCCTGCATTC 58 135-153 AY552904
MNT335 (GT)12 TTTTGTGTTTTGCTCATGCTG ACTTGCAGATTCTCCCACTGTAG 58 227-244 AY552905
MNT336 (GT)15imp TGAGCTGCAGAATCATGACC TTATTTAGATCATCCTCACACTAGACAC 60 151 AY552906
MNT337 (CA)11 TCAGGAGACAGATGAGAAACTGAG TCCACACAGAGAATGCCCTAC 60 279-283 AY552907
MNT338 (CA)20(TA)10(TG)3(TA)12 CCGTTGTTTCTTAATCTCACACC CATATATGTATGTATAAATGTACATG 60 142-165 AY552908
MNT340 (GT)12 CCCATTTAGATGTGCCAGATTAG CAAAATGTGCAGTCCTTTCC 60 119-121 AY552910
MNT341 (CA)13imp ATAAATGCACTTTCCCTTTGC TAACTGCTCTTTCGCCATTG 60 236-242 AY552911
MNT342 (CA)17 ACCCCAGCACTGTTTTCATC CCATTTAAGTGTGTGATTTTCAGG 60 181-183 AY552912
MNT343 (GT)18(AT)10imp GAAACTCCTGCAATCTTCTGTG GATAGCCAATAGCATGTACATATCC 60 168-169 AY552913
MNT344 (CA)26 ATATTGCCTTCCACAAGCAG GCCCAGCAATTCTAGTCCTC 60 166-196 AY552914
MNT346 (GT)9 ATGCAGAAACTCCTGGGAAG TTCCTTTGCCAAAATCAAGG 60 199 AY552916
MNT347 (CA)15 AAACATCTCAACACTCAACATGAAG TTCTTTTGGACACCCTTATTCAG 60 242-254 AY552917
MNT348 (CA)11 TGGGACCAAAGGTATTTTCC CAAGATAGAGCACAAACAAGTGC 60 133-149 AY552918
MNT349 (TG)16 GGGCAACTTTAACTCCCAATAG AAATGGGATGTTTGCTGACC 58 215-221 AY552919
MNT350 (CT)9+(CA)15 AGACCCACTCCTCCTCAAATC AGTGCAACATGAAGGACACG 60 248 AY552920
MNT351 (TG)11 TGGCGTGAAGGTGATAGTTG TCCATGTGCTCATTCTCAGG 60 212-214 AY552921
MNT352 (TG)19 + poly T AAAACATTCAAGATGGTTTTAGTCC ACACAAATGTGTGGTAGTAACAATC 58 159-175 AY552922
MNT353 (TG)10 ATGGAAGGCATGACTTTTGG AGTTGGGTGGAATCCAGATG 58 167-171 AY552923
MNT354 (CA)12 GCTTTCTGCGGCTTACATTC TGTGCATGCCCTACAGAGTC 60 249 AY552924
MNT355 (TA)3 + (TG)14 + (TA)13 CCTTTCTTGCTCTTGCCAAC TTGGACCGTCAAGACCTTTC 60 176-264 AY552925
MNT357 (CA)18 CAAGAACTCACACCAATGAGC TAGATGTAATGCCCGCACAC 56 221-228 AY552926
MNT358 (CA)11 CTTCACAGCATTTGCAGCTC CATGTTATGCTGTGCTTAGCC 60 165-192 AY552927
MNT359 (CA)17 imp TTTACTTTCATTCCCTTCACAGC ATCCCCAGCACTTCATCATC 60 248-250 AY552928
MNT360 (CA)11 CTACGTTTTGTTGCTGCAATG  CTGGAAAGGTGAGAGCTTGG 60 209-241 AY552929
MNT361 (TA)4+(TG)15+(TA)6 TGTCATGGTCAGTGTTGCAC TCCTCTAGGAGTGCCTTTTCC 60 196-207 AY552930
MNT362 (GGA)7 CGAACAGACGCAGCAATTAG CCCTATCCAGAGCTGCTCAC 60 299 AY552931
MNT364 (CA)13 CAGAGCTTTAGCACAAGAAAATG GCTCTGGCTCTTGAACTTGC 60 297-303 AY552932
MNT365 (TG)18 GATCCGTGCATGTGCTTTAG AATGTGAAGATGGCGGAGTC 60 288-290 AY552933
MNT366 (CA)15 GGAACCAGGTAATCCTGCAC ACACAGCGTTCACCTCACTG 60 206 AY552934
MNT367 (CA)13 CCTCACAATCAGCACTTTGG GGTGCATGTGACCTTTTCAC 60 195 AY552935
MNT368 (TG)12 imp + (GA)7 AAATTGTGCTGGCTCCAATG TCCTTGACCCTGGGTATTTG 60 211 AY552936
MNT369 (TG)12 imp TGTTCCTGTCAAAGGAGAAACTG TTTTCGAAGCTTTTGTTTAAGAGAG 60 164-172 AY552937
MNT370 (CA)13 AACACAGTGACCCTGCCAAC  TTTTCTTCCCCTCTTTGTTTTC 60 271-291 AY552938
MNT371 (TG)22 AGCAACAAATCAAATGCACAG TTGGGCTGCCTTAAAGTCTC 58 215-223 AY552939
MNT372 (CA)12 AGCACGAGGGCATTAGAGAC GCAAATAATCTGAATTTCATGTCG 58 166-169 AY552940
MNT373 (CA)18imp CTGCCGCACATTCACACC TCAGTCTGGAAAGAAGCGAAC 56 115 AY552941
MNT374 (CA)24 TGGTAGGCAAAAGGAAGCAG TCAAACGTGATCTGTTTGGAG 58 227-245 AY552942
MNT375 (TG)14imp CTTCAGCTCAAGACTGATTCAAG AACTGGTTTCCAGAGGATGC 56 157 AY552943
MNT376 (CAG)8imp TCATAGCATTCAGGCCACAG CTCTGCTCACAGGGCTTCTC 58 205 AY552944
MNT377 (CT)28 TGAATTCTTTGGATCCGACAC AAGTTCAACAGCTCCTTCTGTG 58 155 AY552945
MNT378 (CA)14 AAGGCATCTAGGGACAAATCC TGCAAAATATGTGGAATGTGC 56 128-144 AY552946
MNT379 (TG)28imp GAATCTGCAGAATGGTTAAGCTG GGGCAAAGAAGTGACTCTGG 56 101-120 AY552947
MNT381 (CA)24(CAA)19 TGAAGTTTCACAAGCCAATTTAC AAGGGGAAGCTTAGCAGAGG 58 207-231 AY552949
MNT382 Tn(TC)8Tn TTGCCAGCAAGGATCTAGTG TCCTTGTAATCATGAACAAACTGG 58 114-123 AY552950
MNT383 (TG)14 ACCTCATAATGGCCACATCC   CTACAGCCAAGGCACATACG 58 112 AY552951
MNT384 (CA)14imp AGCCAAGCTAGGGAAAGGAG GGCTGAGATAAAGGCACAGC 58 129-136 AY552952
MNT385 (CA)16imp GGCACACAGAAGGCAGAAAG TAAGCAGAGCGTGTGAGGTG 60 139-151 AY552953
MNT386 (CA)14 TGATATCTTGGCACAGGAAGG CATCACTGGGAAATCTTTTGC 60 237-249 AY552954
MNT387 (GT)19 AAGCGTTCCATCTGTTTTGG TTCCTAGCCTCTCATCTGTGC 56 130-135 AY552955
MNT388 (GT)6An(CA)18 GACGAAAACTATTGAGAACAAATGAG GGTCTTTCCAACCTAAATTATTCTATG 60 171-193 AY552956
MNT389 (TG)22 TAGCTTCTTTCTATAAATGTTCCTGTG TCACAAAGGAAGGAAGGAAAAC 58 304-340 AY552957
MNT390 (GT)16 AAGCTGTTGTAAAACAAAGGACTTC GGTAAAGGGCAGTGGTCAAG 54 191-199 AY552958
MNT391 (GT)29 CATCCATCCCCAGAAGACTG AACAGCTGTCTGCCAAAAGG 60 165-202 AY552959
MNT392 (TG)11 GAAGGCTGTGCCTCTGTAGG  CACGTAGCAGGAGTCTACATTG 58 291 AY552960
MNT393 (GT)16 TACTCCAGAGTTGCAAGTAATGC  CTGTTGGAGCTGGGGTATG 58 99-119 AY552961
MNT397 (CA)8 +(CA)9 imp TGCAAGAGAGGACTTTGCAG GAATTCTGCACCAGCCTAATG 58 269 AY552962
MNT398 (CA)22 AGGCATTTTGGATGAACCTG CAAAGATTTTGGCAGTCATTTC 60 183-193 AY926536
MNT399 (AC)19 TCAGCTGCACAAATCACAGTC TCCCAGTTTGGAGAGACATTC 60 120-126 AY926537
MNT400 (TG)15 GCGCACGCTCTTTCTGTAAC TCTATCTGCTCGCTGCTTCC 60 164-184 AY926538
MNT401 (CA)33 TTGAAAGATGCATCCCTTTTG AAAGGAGGGGAAGTTTGTGC 60 150 AY926539
MNT402 (TG)6 +(TG)27 GCTAGAAGTCCCAGGGAACC ACAGGTCACATCCTTCATTAGAC 60 128-186 AL592658
MNT403 (GT)23 TGTTTTGTTGCATTATTTTAGCC TCCACGCTCCATATCTTTCC 60 214-230 AL592737
MNT404 (TG)22 AACCAGCTCTGGAGATACCG GGACTGCAAGGACAACATCC 60 283-297 AL593651
MNT405 (GT)18 GGGAAAAGAGGAGAGGCAAC CCTGACTCAGCTCCAAACTG 60 244 AY926540
MNT406 (GT)12 + (GA)14 TTTGGCTTCAGATATCCCTAATG TGTCCAATGAGAACAGGCATAC 60 156-158 AY926541
MNT407 (TG)20 AAAGACAGGCAAGCAACGAG TCTGTCCAACAGCATCCAAC 60 145-161 AY926542
MNT408 (GT)28 GTGTCCCTGCCACACTACAG GGGAATTTGCTCCAACTGAC 60 226-234 AY926542
MNT409 (TG)34 imp AAATCTCCTCCGAGACAGGAC ATGGAGGTGCCAGAGGAAC 60 147-193 AY926543
MNT410 (TG)24 TCTGGTTCACATTGTTTCACTC CCTTTCCCTGTGCATAGCTG 60 165-171 AL593356
MNT411 (CA)20 GCTAACTGCACTTAATTGGGAAG CATGTTTGGAGAAATCCAGTCTC 60 184-198 AL592718
MNT412 (CA)23 CCCATGTGAGCAGTGAATTG GTCATCACAGTGGAGGATCG 60 162-166 AY926544
MNT413 (TG)26 CCTGCCTCTTGTTGAAAAGC TGAAACTGGTGTTGACATGATTG 56 161-171 AY926545
MNT414 (AC)18 ATCACAGTCAGCCCAGCAC GCTGAAATGTGTAGGGCTCTG 60 231-241 AY926546
MNT415 multiple GTAGCTAAACATTGAAAGTACCACTG ACTTCAGTTGCTGGCTGAGG 60 135-155 AY926547
MNT416 (AC)23 AAAAATTAAAGATGCTTAGTACAGTCTTTC TGGTTGGTTATACTTATTTCTTTTTGC 60 156-164 AY926548
MNT417 none CTAGTTCCAGGAGGATGGTG AGTTCAAGCTGCATAGGAAGG 58 252-255 AY926549
MNT418 (TC)11 GTGGGTGTTCACCTTCAACC AGTTACGGAGGCTGTGCTTC 58 222 AY926550
MNT419 (CA)4 + (CA)6 CCATCACCTCCCAGTACCAC CCCTCCCTCATTGCTCATAC 58 272 AY926551
MNT420 (CA)10imp GTGGGAGACTTCCCTCACG GAGAGCTGCTCCTTCACCTG 58 241-247 AY926552
MNT421 <600 bp GA combination GGAGCTCCGACAACAATAATATG CCAAAGGTTCGTTGGTTCG 60 697-?  AY926553 
MNT422 (CT/CA)9 AGGCTGAAGTGGCTGTATGC TGAAAAGTTGCCATGTCTTGTC 60 498  AY926554, AL593272, 
MNT423 no repeat TCACTACCTCCTGGCAATCC TTTTGCTTCACTGTTTATCTGG 60 136  AY926555, AL593214, 
MNT425 (TG)14 CCAGCCAGATTCTTGTGTTTTG AGCACATGCTTTCAGTTACATCAC 60 290  AL592590, AL592591, 
MNT427 (TG)24 GACTGTTGAATCAGCTAGAATAGCAC GGGATCCAGAAATTCAGTTTG 60 340-354  AL592640, AL592641, 
MNT428 no repeat CTCAGGGTGAACCTGGAAAC TCTCAACGGGTTTCAGAAGAG 56 500  AL592642, AL592643, 
MNT429 (GT)22 TTGATTTCTGGCCATTTGC ACAGTGCCTCATTGGAAAGC 60 280-294  AL592644, AL592645, 
MNT430 (CA)12 AAAGCTGTCCTCTGGTCAGG ATGCATTTCTGTGGGAGGTG 60 209-235  AL592650, 
MNT431 (CA)20 TCAGGGAGTTTCCACCTCAG TTTTGAGCTCAGGAAAAGAAGC 60 270  AL592662, AL592663, 
MNT432 (CA)26 CATACATGGAAAAGGCACCAC TGTATGCACTGCAGCTTGTG 60 375  AL592671, AL592672, AL592890, AL592891, 
MNT433 (TG)23 CACACCGACTGGAAAAGGTC TGCTTTGGGCCTAAAATGAG 60 248-260  AL592677, AL593805, 
MNT434 (CA)14 CGTGAATTTTATCTGCTGTTGC TTCACCAGATTTCACGTTCG 60 200  AL592702, AL592703, 
MNT436 (CA)22 ACAGCCGCCCTTGTATGG AAATACCACGCCATCTCTGC 60 160-235  AL592829, AL592830, AL592812, AL592813, 
MNT437 (TG)23 GCACTGCAATTCAAGTGAGC TGCTTGCAATCAACCAAATG 60 245-270  AL593814, AL592931, 
MNT438 (TG)8  TGCTCCTGGAAGTCTATCTGC TCCCCAAGAGTTATGCAGTTC 58 180  AL592966, AL592967, 
MNT442 (GT)9 ATTTTCTTTCACCTGAGTTGAGC GCTGCACAGTTGCTGACTTC 60 245  AL593052, AL593053, 
MNT443 (CA)12 TTGGCATTTAACTGCAGAGG GGTCTCTCAAGCCACTCCTG 60 185-195  AL593060, AL593061, 
MNT444 (CA)7 ACGGACCACTGCTTGCTTAC AGGGTGTTGAATGGGATCAG 60 215  AL593100, AL593101, 
MNT446 (GT)7 GCAACACTGCAGCCAAAAC TCTGCAAAGAGGAGAGATTGC 60 250  AL593110, AL593111, 
MNT447 (GT)10 imp TGACAGATCCAGCATTCAGC GCTGTATTTTCGCCCTTTTC 60 220  AL593114, AL593115, 
MNT448 (CA)22imp CTTCTTGGCTTACCAAACCAG GGCCCAGCTCCCATAGAG 60 296-300  AL593178, AL593179, 
MNT449 (GT)15 imp TTGCTTCTGCTTTCTTTCCTG AAGATGGCTCATCCAAATGC 60 230-240  AL593182, AL593183, 
MNT450 Poly A TGCAATGCTCACCTCATTTC CATGATAAGGCAAGCCAAAG 60 168-179  AL593308, AL593309, 
MNT451 (GT)14 CTCGAGATTGAAACCCTTCTG AGCCCACACTCATCCTTGAC 60 250-266  AL593615, AL593616, AL593323, 
MNT452 (GT)8 + polyT imp TGGACAAGTCTGAAAGCTAAAGTG TGCGCTTCTAATGAATGCTG 60 290  AL593342, AL593343, AL593526, AL593527, 
MNT453 multiple CTGCTTGCTGCTGGAGTATG GGGAGGAGAGGGAATGTTTG 60 390  AL593364, AL593365, 
MNT454 (TG)17 GACCCAGCCACTGGGAAG GTCCAGCCTTGCAGAACAAC 60 126-136  AL593401, AL593402, 
MNT455 (CA)12 CATGACAGTATGCCATGGTTG TCTGCATTTCACGTGGTTAC 60 170  AL593464, AL593465, 
MNT456 (GT)10 TAAAGCCTTTGTGCCAGTCC CCACCTTAAAGCAGCATGAG 60 306-308  AL593466, AL593467, AL593468, 
MNT457 (TG)12 TTAAGCCCTTATTATGCAGGTG TGCAACTGCTGCATTTTCTC 60 250  AL593469, AL593470, 
MNT458 multiple AAGTCGAAATAATCAGGCATAGG AAGTCAGGGTGCAGAAGTGG 60 180  AL593487, 
MNT461 (TG)8 imp TTTGCAGTCTTTCTCCTCCAG CAAAGGACATTTGTTGCCAAG 60 240  AL593511, AL593512, 
MNT463 (CA)24 CTTGTGACACGTCCTGTTGC AGACCTAGGCTCAGTGTGCTG 58 550  AL593534, 
MNT464 (CA)25 CTTAGGTGCTTGCCAAAAGC AATGAATGGGACACCAGAGC 60 282  AL593549, AL593550, 
MNT465 (CA)14  TCTCGGTACATGCTGCTCAC GTTGGAGAAAGGCAGGCATC 60 280  AL593555, AL593556, 
MNT466 (TG)7 TTCTTGGACATGTTCTTGTGG GCTTTGAAATCGCCAGGTAG 60 270-275  AL593563, AL593564, 
MNT467 (AC)19 AGTGGCAGTTTGTGGATCTTG TCGTACTGGCAGGCATGTAG 60 230-236  AL593567, AL593568, 
MNT468 (CA)13 TCCTCCAGTGCTTCATGTTG CCAGGTGGGTTTTACTGAGC 58 230  AL593573, AL593574, 
MNT470 (CA)45 TTTTGGTTTCTGAGTACGAACAAG AACACCTGTCATGCCAAAGC 60 220  AL593623, AL593624, 
MNT471 (GACACACA)21 AACTCCTGGATCCATCTAAGC CCTGCTATTATGGGATAGCAAAG 56 288  AL593645, AL593646, 
MNT472 (GT)25 CAGCACAAGTCAAAGGAATACAAG TGTGAGGGGAGTGAAGAAAAG 60 450  AL593164, AL593165, AL593661, 
MNT474 (CTTT)22+ AAGCAACGGAAGAACAATGG CTGCCACATTCCTGGAGAAG 60 300  AL593703, 
MNT475 (CA)9imp AAAATCAAGTTACACAAGCAAATTC GGCCTGCTTTCCACATTTTC 60 245  AL593715, AL593716, 
MNT477 (CA)9 TTCACCACGCTCATTCAAAG TCCAAAATGTGACTAGATGATAAAGTG 60 230  AL593755, 
MNT478 (CA)11imp TCCATTAGATGGCTGGTCAC TCAGAGTCCCAATGGGGTAG 60 160  AL593769, 
MNT479 (CA)18 imp CTTCACATCTTTCCGTTCCTG CTGCTTTAGGGTGGTTCCAG 60 124-128  AL593793, AL593794.
MNT-Nm13_14 (CA)12+(TA)6 GTATATTACATGGGCAGGATGC TTTCCAATCATCGAATAAGGTC 58 EF091365

References

  1. Reed KM, Roberts MC, Murtaugh J, Beattie CW, and Alexander LJ.  2000.  Eight new dinucleotide microsatellite loci in turkey (Meleagris gallopavo). Animal Genet. 31:140.
  2. Reed KM, Chaves LD and Rowe JA.  2002.  Twelve new turkey microsatellite loci.  Poultry Science, 81:1789-1791.
  3. Reed KM. 2002.  FHF-2 in the turkey (Meleagris gallopavo ).  Animal Biotech, 13:203-209.
  4.  Dranchak P, Chaves LD, Rowe JA, and Reed KM.  2003.  Turkey microsatellite loci from an embryonic cDNA library.  Poultry Science, 82:526-531.
  5. Reed KM, Chaves LD, Hall MK, Knutson TP, Rowe JA, and Torgerson AJ.  2003.  Microsatellite loci for genetic mapping in the turkey (Meleagris gallopavo).  Animal Biotech, 14:119-131.
  6. Knutson TP, Chaves LD, Hall MK, and Reed KM.  2004.  One hundered fifty-four genetic markers for the turkey (Meleagris gallopavo).  Genome, 47:1015-1028.
  7. Chaves LD, Knutson TP, Krueth SB, and Reed KM. Using the chicken genome sequence in development and mapping of genetic markers in the turkey (Meleagris gallopavo). Animal Genet, 37:130-138.
  8. ReedKM, Mendoza KM, HuGR, SullivanLR, Grace MW, ChavesLD and Kooyman DL. 2007.     Genomic analysis of genetic markers associated with inherited cardiomyopathy (round heart disease) in the turkey (Meleagris gallopavo). Animal Genetics, 38:211-217.